Loading…

Bioinformática – Tópico 1

Tópico 1 – Introdução

A Bioinformatica é uma linha de pesquisa criada para o estudo de dados genéticos, para isso, ela utiliza ferramentas computacionais para analisar esses dados. Sua principal finalidade é desvendar a grande quantidade de dados providos do sequenciamento de DNA e proteínas.

Uma combinação de Ciência da Computação, Tecnologia da Informação e Genética para determinar e analisar informação genética.

-Bits Journal – Bioinformatics: Information Technology Systems

Outras definições:

Aplicação de ferramentas de computação e análise para captura e interpretação de dados biológicos;
Integração de métodos matemáticos, estatísticos e computacionais para analisar dados biológicos, bioquímicos e biofísicos;
Ciência e tecnologia sobre aprendizado, gerenciamento e processamento de informação biológica;

Áreas envolvidas: Ciência da Computação, Engenharia de Software, Matemática, Estatística e Biologia Molecular.
Sistema operacional necessário para pesquisa: Linux ou algum sistema baseado no Unix.
Banco de dados utilizado: Mysql.
Linguagem mais utilizada atualmente: Java.

Diferente do alfabeto binário dos computadores, os dados genéticos são armazenados com um alfabeto quaternário A, C, G e T que são bases nitrogenadas de uma molécula de DNA.

A – Adenina
G – Guanina
T – Timina
C – Citozina

Então, quando se faz um sequenciamento de DNA determina-se a ordem dessas bases nitrogenadas. Por exemplo: CGAAGTCGAGCCAGTTAAACGGCCATGGTACCAATGA